Cảmâm, tablature, hợp âm, tabs guitar, ukulele, lời bài hát: Ku Takkan Bisa - Nidji - ( (intro) A D A D memang kau [A]yang takkan bisa memeluk d) Cảm âm bài hát 2 years ago 291 Let's Play (2009) Nidji AmF C bisa.. kuputarkan kembali seperti dulu.. G Am ku bahagia tapi semuanya hilang, tanpa sebab F C G kau hentikan semuanya.. ho oooo.. F terluka dan menangis tapi kuterima Am semua keputusan yang telah kau buat F satu yang harus kau tahu Dm G ku menanti kau tuk kembali.. Reff : C G/B jujur ku tak ingin engkau pergi.. E G F C Em Dm D Cm Am Bb Gm A Ab Bm] Chords for #16TahunIRadio Slank - Ku Tak Bisa with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin. Vay Tiền Trả Góp Theo Tháng Chỉ Cần Cmnd. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNNNNNNGNNNCNNNNNNNEmNNNNNNNFNNNNNNNCNNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNCNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNCNNNGNNNCNNNNNNNNNEmNNNNNFNNNNNNNCNNNGNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNANNNNNNNGmNNNNNNNBmNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNFNNNNNNNFmNNNNNNNNNNNNNNNNNNNDmNNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNNCNNNNNNNGNNNNNNNNNNNFNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNGNNNDNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNNNNNNNNNDmNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose EEFmEAEEEEEEEEEEEEEEEEEEEEEFmEAEEEEEFmEAEEEFmEEEFmEEEFmEEEBEEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEBEEEEEEEEEEEEEFmEAEEEEEFmEAEEEFmEEEFmEEEFmEEEBEEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEBEEEEEEEEEEEEEEEEEEEEEEECmEBEAEEEBCDEmAEEECmEBEAEEEEBEEAEEECmEBEAEEEEBEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEEBEEEEFmEAEEEEEEEEEEEEEEEEEEEEEN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi 338 clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose AAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAAGAACAAAAAAAEmAAAAAAAFAAAAAAACAAAGmAAADADmAAAAAFAAAAAAACAAAAAAAGAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAGAAAAAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAGAAACAAAAAAAAEmAAAAAAFAAAAAACAAAGAAAADmAAAAAAAFAAAAAACAAAAAAAAGAAAAAAADmAAAAAAAFAAAAAACAAAAAAAGAAAAAAAAAmAAAAAAAEmAAAAAAAAmAAAAAAEmAAAAAAAAAAAAAAAGmAAAAAAAABAAAADmAAmAAAAAAAEmAAAAAAAAmAAAAAAAEmAAAAAAAFAAAAAAAFmAAAAAAAAAAFAAAAAAAACAAAADmAAAAAAAAAFAAAAAAAACAAAAAAGmAGAAACDmAAAAAAAAAFAAAAAAAACAAAAAAAGAAAAAAAAAAACADADmAAAAAAFAAAAAAACAAAAAAGAAAAAAAADmAAAAAAAFAAAAAAACAAAAAAGAABmAAGADmAAAAAAAFAAAAAAACAAAAAAGAAAAAAAAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAAAAAAAAAAAN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

chord ku tak bisa ukulele